Skip to Content
Merck
All Photos(1)

Documents

EHU062211

Sigma-Aldrich

MISSION® esiRNA

targeting human PRDX5

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGTGCTGTTTGGAGTTCCTGGGGCCTTCACCCCTGGATGTTCCAAGACACACCTGCCAGGGTTTGTGGAGCAGGCTGAGGCTCTGAAGGCCAAGGGAGTCCAGGTGGTGGCCTGTCTGAGTGTTAATGATGCCTTTGTGACTGGCGAGTGGGGCCGAGCCCACAAGGCGGAAGGCAAGGTTCGGCTCCTGGCTGATCCCACTGGGGCCTTTGGGAAGGAGACAGACTTATTACTAGATGATTCGCTGGTGTCCATCTTTGGGAATCGACGTCTCAAGAGGTTCTCCATGGTGGTACAGGATGGCATAGTGAAGGCCCTGAATGTGGAACCAGATGGCACAGGCCTCACCTGCAGCCTGGCACCCAATATCATCTCACAGCTCTGAGGCCCTGGGCCAGATTACTTCCTCCACCCCTCCCTATCTCACCTGCCCAGCCCTGTGCTGGGGCCCTGCAATTGGAATGTTGGCCAGATTT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Marshall Ellison et al.
Cell communication and signaling : CCS, 18(1), 15-15 (2020-01-29)
We have previously shown that the zinc finger transcription repressor SNAI2 (SLUG) represses tumor suppressor BRCA2-expression in non-dividing cells by binding to the E2-box upstream of the transcription start site. However, it is unclear how proliferating breast cancer (BC) cells
Gui-Nan Shen et al.
Molecular medicine reports, 17(6), 7827-7834 (2018-04-06)
High concentrations of glutamate may mediate neuronal cell apoptosis by increasing intracellular reactive oxygen species (ROS) levels. Peroxiredoxin V (Prx V), a member of the Prx family, serves crucial roles in protecting cells from oxidative stress. The present study investigated
Geoffroy Walbrecq et al.
Free radical biology & medicine, 84, 215-226 (2015-03-17)
Peroxiredoxin-5 (PRDX5) is a thioredoxin peroxidase that reduces hydrogen peroxide, alkyl hydroperoxides, and peroxynitrite. This enzyme is present in the cytosol, mitochondria, peroxisomes, and nucleus in human cells. Antioxidant cytoprotective functions have been previously documented for cytosolic, mitochondrial, and nuclear

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service