Skip to Content
Merck
All Photos(1)

Documents

EHU034841

Sigma-Aldrich

MISSION® esiRNA

targeting human FDXR

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGGATTTCTTGGGTCTCCAGGACAAGATCAAGGAGGTCCCCCGCCCGAGGAAGCGGCTGACGGAACTGCTGCTTCGAACGGCCACAGAGAAGCCAGGGCCGGCGGAAGCTGCCCGCCAGGCATCGGCCTCCCGTGCCTGGGGCCTCCGCTTTTTCCGAAGCCCCCAGCAGGTGCTGCCCTCACCAGATGGGCGGCGGGCAGCAGGTGTCCGCCTAGCAGTCACTAGACTGGAGGGTGTCGATGAGGCCACCCGTGCAGTGCCCACGGGAGACATGGAAGACCTCCCTTGTGGGCTGGTGCTCAGCAGCATTGGGTATAAGAGCCGCCCTGTCGACCCAAGCGTGCCCTTTGACTCCAAGCTTGGGGTCATCCCCAATGTGGAGGGCCGGGTTATGGATGTGCCAGGCCTCTACTGCAGCGGCTGGGTGAAGAGAGGACCTACAGGTGTCATAGCCACAACCATGACTGACAGC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Luofu Wang et al.
PloS one, 9(5), e96586-e96586 (2014-05-07)
The objective of this study was to investigate nanobubbles carrying androgen receptor (AR) siRNA and their in vitro and in vivo anti-tumor effects, when combined with ultrasonic irradiation, on androgen-independent prostate cancer (AIPC). Nanobubbles carrying AR siRNA were prepared using
Valerie N Barton et al.
Molecular cancer therapeutics, 14(3), 769-778 (2015-02-26)
Triple-negative breast cancer (TNBC) has the lowest 5-year survival rate of invasive breast carcinomas, and currently there are no approved targeted therapies for this aggressive form of the disease. The androgen receptor (AR) is expressed in up to one third
Xianwei Li et al.
The Korean journal of physiology & pharmacology : official journal of the Korean Physiological Society and the Korean Society of Pharmacology, 19(5), 401-411 (2015-09-04)
Aldose reductase (AR) is known to play a crucial role in the mediation of diabetic and cardiovascular complications. Recently, several studies have demonstrated that allergen-induced airway remodeling and ovalbumin-induced asthma is mediated by AR. Epalrestat is an aldose reductase inhibitor
Tao Shan et al.
Cancer science, 105(7), 847-856 (2014-05-13)
Norepinephrine and epinephrine, catecholamine hormones that are major mediators for chronic stress-induced cancers, are implicated in the progression of a number of cancer cells, including gastric adenocarcinoma. However, the underlying mechanisms of these hormones have not been well elucidated. Epithelial-mesenchymal
S H Akter et al.
Veterinary pathology, 52(6), 1027-1033 (2015-03-11)
Controversies remain regarding the cell type from which human prostate cancer originates, and many attempts have been made to identify the cellular origin of canine prostate cancer but without definitive proof. This study aims to evaluate the expression of luminal

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service